Top » Catalog » Q » BZ2202

$18.00

BZ2202
[BZ2202]

BZ2202
HG19 Position: ChrY:11694136..11694136
Ancestral: A
Derived: C
Reference: Vladimir Gurianov (2016)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: BZ2202_F AATTGGAATCAAATGGAATATAATCG
Reverse Primer: BZ2202_R ATTCCGTTCATTACCATACAGTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies