Top » Catalog » Q » BZ560

$18.00

BZ560
[BZ560]

BZ560
hg38 Position: ChrY:8701631..8701631
Ancestral: G
Derived: C
Reference: Q Y-DNA Haplogroup project (2016)
ISOGG Haplogroup: Q
Comments: L329
Forward Primer: BZ560_F ACTAATATCCCCTTCTGGCCAC
Reverse Primer: BZ560_R CCAGAACAAGTTGAATAAGTTAGCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies