Top » Catalog » Q » BZ573

$18.00

BZ573
[BZ573]

BZ573
hg38 Position: ChrY:19457677..19457677
Ancestral: A
Derived: G
Reference: Q Y-DNA Haplogroup project (2016)
ISOGG Haplogroup: Q
Comments: L329
Forward Primer: BZ573_F GTGATTCCGCAATCTCATGG
Reverse Primer: BZ573_R TCCCTCTCCCACCTACACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BZ1664
$18.00
Haplogroup Info
Other products
Currencies