Top » Catalog » Q » A15885

$18.00

A15885
[A15885]

A15885
hg38 Position: ChrY:12058748..12058748
Ancestral: G
Derived: C
Reference: Alessandro Biondo (2017)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: A15885_F GTGGAGGGGAGAATGGAATC
Reverse Primer: A15885_R CTTGTAAGGCAAGCCTGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC67293
1 x CTS9501
$36.00
Haplogroup Info
Other products
Currencies