Top » Catalog » Q » A15889

$18.00

A15889
[A15889]

A15889
hg38 Position: ChrY:21316728..21316728
Ancestral: G
Derived: C
Reference: Alessandro Biondo (2017)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: A15889_F AAAGGACAACATATGTAAACTTTATATTCAGTG
Reverse Primer: A15889_R AGAATGTTTTGGAACTAGGTGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies