Top » Catalog » Q » L54

$18.00

L54
[L54]

L54
hg38 Position: ChrY:21130896..21130896
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2a1
Comments: .
Forward Primer: L54_F TGTTTGTTGACCCCGTTTTG
Reverse Primer: L54_R AGGAGATTGTAAGTGGCATGG
Reviews

Customers who bought this product also purchased
M930
M930
A19001
A19001
M1107
M1107
YP4064
YP4064
L53
L53
YP4025
YP4025
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies