Top » Catalog » Q » FGC8457

$18.00

FGC8457
[FGC8457]

FGC8457
hg38 Position: ChrY:13700191..13700191
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: Q (not listed)
Comments: .
Forward Primer: FGC8457_F ACATTGGAGAGCCCTCAGTC
Reverse Primer: FGC8457_R GCCTGAGAATCACCAGGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies