Top » Catalog » R1a » S18681

$18.00

S18681
[S18681]

S18681
hg38 Position: ChrY:14587828..14587828
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1a1a1b1a2b3
Comments: Downstream Y33 > CTS8816
Forward Primer: S18681_F GAATGCCCTCACACCTAACC
Reverse Primer: S18681_R CCTGCTCCTTCTGTGAAATG
Reviews

Customers who bought this product also purchased
Y35606
Y35606
PF5327
PF5327
BY79500
BY79500
Z283
Z283
L145
L145
M343
M343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies