Top » Catalog » R1a » S18681

$18.00

S18681
[S18681]

S18681
hg38 Position: ChrY:14587828..14587828
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1a1a1b1a2b3
Comments: Downstream Y33 > CTS8816
Forward Primer: S18681_F GAATGCCCTCACACCTAACC
Reverse Primer: S18681_R CCTGCTCCTTCTGTGAAATG
Reviews

Customers who bought this product also purchased
M173
M173
PH864
PH864
P295
P295
FGC40572
FGC40572
M9
M9
Y2915
Y2915
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12432
1 x A2026
1 x SRY10831.2
1 x Y20573
1 x ALK304
$90.00
Haplogroup Info
Other products
Currencies