Top » Catalog » R1a » BY153939

$18.00

BY153939
[BY153939]

BY153939
hg38 Position: ChrY:13555797..13555797
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: Below Z282 > Y35 > Y951 > FGC21222
Forward Primer: BY153939_F CCAATAGGAAGAGAAACATACCCC
Reverse Primer: BY153939_R AGGAGAATATTATTTACATGCTTCAAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19327
$18.00
Haplogroup Info
Other products
Currencies