Top » Catalog » R1a » A25195

$18.00

A25195
[A25195]

A25195
hg38 Position: ChrY:20457869..20457869
Ancestral: A
Derived: G
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A25195_F TGAGAACATGAGGTGTTTGGTTC
Reverse Primer: A25195_R ACATTTATGCCACCAACTGATG
Reviews

Customers who bought this product also purchased
A25192
A25192
A25196
A25196
A25194
A25194
A25193
A25193
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19343
$18.00
Haplogroup Info
Other products
Currencies