Top » Catalog » R1a » S7737

$18.00

S7737
[S7737]

S7737
hg38 Position: ChrY:6927842..6927842
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1a1a1b1a3b2 (not listed)
Comments: Below S223/Z287 > CTS8277 > S5708
Forward Primer: S7737_F GCTGGAATTACAGGTGTGAGG
Reverse Primer: S7737_R AAAACTCTAATGTGAAATGCAAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies