Top » Catalog » R1a » A5414

$18.00

A5414
[A5414]

A5414
hg38 Position: ChrY:21395217..21395217
Ancestral: T
Derived: G
Reference: Szymon Eryk Borowski (2015)
ISOGG Haplogroup: R1a1a1b1a1a1a1 (not listed)
Comments: Downstream YP616 > YP1365
Forward Primer: A5414_F GGTTTGGTATGCAATAACTATTATTTGG
Reverse Primer: A5414_R GAGGAAAGCAGATATTTCCAAATAGG
Reviews

Customers who bought this product also purchased
Y16235
Y16235
L260
L260
YP415
YP415
L1029
L1029
YP414
YP414
R1a-M458 Panel
R1a-M458 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies