Top » Catalog » R1a » Y874

$15.00

Y874
[Y874]

Y874
hg38 Position: ChrY:15980027..15980027
Ancestral: C
Derived: A
Reference: Semargl and Centurion (aka Maximus)
ISOGG Haplogroup: R1a (not listed)
Comments: downstream of Z2123
Forward Primer: Y874_F ACTTGAGTCTGCGGCATTTC
Reverse Primer: Y874_R TATCCGACTTATGGCGCTTG
Reviews

Customers who bought this product also purchased
Y2632
Y2632
Z2124
Z2124
Y937
Y937
YP521
YP521
R1a-Z93 Panel
R1a-Z93 Panel
Y934
Y934
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies