Top » Catalog » R1a » Y874

$18.00

Y874
[Y874]

Y874
hg38 Position: ChrY:15980027..15980027
Ancestral: C
Derived: A
Reference: Semargl and Centurion (aka Maximus)
ISOGG Haplogroup: R1a (not listed)
Comments: downstream of Z2123
Forward Primer: Y874_F ACTTGAGTCTGCGGCATTTC
Reverse Primer: Y874_R TATCCGACTTATGGCGCTTG
Reviews

Customers who bought this product also purchased
Y934
Y934
YP525
YP525
Y47
Y47
Y7094
Y7094
Z2123
Z2123
CTS1806
CTS1806
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x M12353
1 x S3226
$36.00
Haplogroup Info
Other products
Currencies