Top » Catalog » R1a » S4442

$18.00

S4442
[S4442]

S4442
hg38 Position: ChrY:13077992..13077992
Ancestral: A
Derived: T
Reference: Jim Wilson
ISOGG Haplogroup: R1a1a1b1a3a1c
Comments: Aka. CTS3802
Forward Primer: S4442_F CTTGTTGTGGGGTAGGGC
Reverse Primer: S4442_R AAAAAAAATTACTAAAACCAATAAAAAACTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies