Top » Catalog » R1a » S2886

$18.00

S2886
[S2886]

S2886
hg38 Position: ChrY:13348114..13348114
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream L664 > S2894 > S2880
Forward Primer: S2886_F ACCCTCCTGAACCTTTTTCG
Reverse Primer: S2886_R TGCTATTGTCTCCAGCATTCTC
Reviews

Customers who bought this product also purchased
YP431
YP431
YP441
YP441
S2880
S2880
S2894
S2894
YP6484
YP6484
R1a-L664 Panel
R1a-L664 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A5559
1 x A9722
1 x Y23179
1 x BY6163
1 x A12310
1 x Y46481
1 x BY9866
$126.00
Haplogroup Info
Other products
Currencies