Top » Catalog » R1a » FGC11912

$18.00

FGC11912
[FGC11912]

FGC11912
hg38 Position: ChrY:17109408..17109408
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1a1a1b1a3a1a1
Comments: Aka YP278 Phyloequivalent to L176.1
Forward Primer: FGC11912_F AATACACTTGGGGAACACACAC
Reverse Primer: FGC11912_R TGCCAAATTCAAGGCAGTATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies