Top » Catalog » R1a » CLD33

$18.00

CLD33
[CLD33]

CLD33
hg38 Position: ChrY:20859456..20859456
Ancestral: G
Derived: A
Reference: Doug McDonald (2014)
ISOGG Haplogroup: R1a1a1b1a3a1a (not listed)
Comments: Downstream YP326 group e
Forward Primer: CLD33_F TCTCTGAAATCGGCAAAACC
Reverse Primer: CLD33_R GGCAACATTATCACCCCAAC
Reviews

Customers who bought this product also purchased
CLD12
CLD12
CLD34
CLD34
CLD21
CLD21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies