Top » Catalog » R1a » A6731

$18.00

A6731
[A6731]

A6731
hg38 Position: ChrY:15697883..15697883
Ancestral: G
Derived: A
Reference: Ian Gillespie (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Below CLD12 > CLD50 > CLD51
Forward Primer: A6731_F CTTCACATCTAAAAATATCCACCAGTAG
Reverse Primer: A6731_R GAAGTTCTTTATATATTCAGTCAGTCATCAG
Reviews

Customers who bought this product also purchased
A6730
A6730
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies