Top » Catalog » R1a » A6730

$18.00

A6730
[A6730]

A6730
hg38 Position: ChrY:21821567..21821567
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream CLD12 > CLD50 > CLD51
Forward Primer: A6730_F TGGGATTTCATTCTGGGAAAC
Reverse Primer: A6730_R GTCATTCTCTGTGAATTGGGAAG
Reviews

Customers who bought this product also purchased
A6731
A6731
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies