Top » Catalog » R1a » A7015

$18.00

A7015
[A7015]

A7015
hg38 Position: ChrY:8523540..8523540
Ancestral: T
Derived: C
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below A7020.
Forward Primer: A7015_F ACTACTTTCTCTTTATCCCTTGATACTATG
Reverse Primer: A7015_R CAGTAGTGCATGTACTCATCTAGTTCAG
Reviews

Customers who bought this product also purchased
A7025
A7025
A7019
A7019
A7024
A7024
A7018
A7018
A7023
A7023
A7017
A7017
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies