Top » Catalog » R1a » A7015

$18.00

A7015
[A7015]

A7015
hg38 Position: ChrY:8523540..8523540
Ancestral: T
Derived: C
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below A7020.
Forward Primer: A7015_F ACTACTTTCTCTTTATCCCTTGATACTATG
Reverse Primer: A7015_R CAGTAGTGCATGTACTCATCTAGTTCAG
Reviews

Customers who bought this product also purchased
A7022
A7022
YP1080
YP1080
A7021
A7021
R1a-YP1078 Segregation Panel
R1a-YP1078 Segregation Panel
A7020
A7020
A7025
A7025
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies