Top » Catalog » R1a » A7017

$18.00

A7017
[A7017]

A7017
hg38 Position: ChrY:12711204..12711204
Ancestral: G
Derived: A
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7017_F GCAACTGCTTTTGTGGAAGAC
Reverse Primer: A7017_R CAGCAAAACCATACACACTGG
Reviews

Customers who bought this product also purchased
A7023
A7023
A7015
A7015
A7022
A7022
YP1080
YP1080
A7021
A7021
R1a-YP1078 Segregation Panel
R1a-YP1078 Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies