Top » Catalog » R1a » A7017

$18.00

A7017
[A7017]

A7017
hg38 Position: ChrY:12711204..12711204
Ancestral: G
Derived: A
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7017_F GCAACTGCTTTTGTGGAAGAC
Reverse Primer: A7017_R CAGCAAAACCATACACACTGG
Reviews

Customers who bought this product also purchased
A7020
A7020
A7025
A7025
A7019
A7019
A7024
A7024
A7018
A7018
A7023
A7023
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies