Top » Catalog » R1a » A7018

$18.00

A7018
[A7018]

A7018
hg38 Position: ChrY:16462116..16462116
Ancestral: G
Derived: T
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7018_F GGGTTCCTGAGGATCAATTATG
Reverse Primer: A7018_R ACAAAACTTGGCTGGGTGTG
Reviews

Customers who bought this product also purchased
A7020
A7020
A7025
A7025
A7019
A7019
A7024
A7024
A7017
A7017
A7023
A7023
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies