Top » Catalog » R1a » A7019

$18.00

A7019
[A7019]

A7019
hg38 Position: ChrY:16596579..16596579
Ancestral: G
Derived: C
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7019v2_F GCAGAATTGCTTGAATCCAC
Reverse Primer: A7019v2_R AAATTATATTTCATTGCATTGCTACAAC
Reviews

Customers who bought this product also purchased
A7023
A7023
A7015
A7015
A7022
A7022
YP1080
YP1080
A7021
A7021
R1a-YP1078 Segregation Panel
R1a-YP1078 Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies