Top » Catalog » R1a » A7019

$15.00

A7019
[A7019]

A7019
hg38 Position: ChrY:16596579..16596579
Ancestral: G
Derived: C
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7019v2_F GCAGAATTGCTTGAATCCAC
Reverse Primer: A7019v2_R AAATTATATTTCATTGCATTGCTACAAC
Reviews

Customers who bought this product also purchased
A7018
A7018
A7024
A7024
A7017
A7017
A7023
A7023
A7015
A7015
A7022
A7022
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies