Top » Catalog » R1a » A7021

$18.00

A7021
[A7021]

A7021
hg38 Position: ChrY:21833655..21833655
Ancestral: T
Derived: C
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7021_F AAACATTTTGGTTGCTTTTCTGC
Reverse Primer: A7021_R GCACTCCAAATGTTCCTTGTACA
Reviews

Customers who bought this product also purchased
A7022
A7022
YP1080
YP1080
A7020
A7020
R1a-YP1078 Segregation Panel
R1a-YP1078 Segregation Panel
A7019
A7019
A7025
A7025
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies