Top » Catalog » R1a » A7021

$18.00

A7021
[A7021]

A7021
hg38 Position: ChrY:21833655..21833655
Ancestral: T
Derived: C
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7021_F AAACATTTTGGTTGCTTTTCTGC
Reverse Primer: A7021_R GCACTCCAAATGTTCCTTGTACA
Reviews

Customers who bought this product also purchased
A7024
A7024
A7017
A7017
A7023
A7023
A7015
A7015
A7022
A7022
YP1080
YP1080
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies