Top » Catalog » R1a » A7023

$18.00

A7023
[A7023]

A7023
hg38 Position: ChrY:16314458..16314458
Ancestral: G
Derived: A
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7023_F GGAGTTATTATTCAAATCGATCTCAC
Reverse Primer: A7023_R TGGGCTACAGGGAGGAAAG
Reviews

Customers who bought this product also purchased
YP1080
YP1080
A7020
A7020
R1a-YP1078 Segregation Panel
R1a-YP1078 Segregation Panel
A7019
A7019
A7025
A7025
A7018
A7018
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies