Top » Catalog » R1a » A7023

$18.00

A7023
[A7023]

A7023
hg38 Position: ChrY:16314458..16314458
Ancestral: G
Derived: A
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7023_F GGAGTTATTATTCAAATCGATCTCAC
Reverse Primer: A7023_R TGGGCTACAGGGAGGAAAG
Reviews

Customers who bought this product also purchased
A7025
A7025
A7018
A7018
A7024
A7024
A7017
A7017
A7022
A7022
A7015
A7015
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies