Top » Catalog » R1a » A7411

$18.00

A7411
[A7411]

A7411
hg38 Position: ChrY:16928427..16928427
Ancestral: C
Derived: T
Reference: Michael Cooley (2015)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A7411_F GCAGCCATCTGAGATTGACC
Reverse Primer: A7411_R GGGTCAGTAACCCGCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies