Top » Catalog » R1a » A7498

$18.00

A7498
[A7498]

A7498
hg38 Position: ChrY:15310041..15310041
Ancestral: T
Derived: A
Reference: Michael Cooley (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP4491
Forward Primer: A7498_F GAGAGGGATGGTTTCAGTTGG
Reverse Primer: A7498_R CCACCACCACCATCACC
Reviews

Customers who bought this product also purchased
A7497
A7497
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies