Top » Catalog » R1a » CTS2787

$18.00

CTS2787
[CTS2787]

CTS2787
hg38 Position: ChrY:12362960..12362960
Ancestral: T
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1a
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS2787_F GCCCTTTTAAACGCTGCA
Reverse Primer: CTS2787_R CCTTATTAGTTAGGTACCCTGAGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16247
1 x M184
1 x FT83787
1 x FGC85544
1 x A6571
$90.00
Haplogroup Info
Other products
Currencies