Top » Catalog » R1a » SUR5

$18.00

SUR5
[SUR5]

SUR5
hg38 Position: ChrY:14851988..14851988
Ancestral: A
Derived: G
Reference: EHP Suyun
ISOGG Haplogroup: R1a (not listed)
Comments: Approx. Y2632
Forward Primer: SUR5_F ATCCCTCTTTCTGCAAGGTG
Reverse Primer: SUR5_R CCTGACCTCAAGGGATTCAC
Reviews

Customers who bought this product also purchased
SUR3
SUR3
SUR73
SUR73
SUR55
SUR55
SUR82
SUR82
SUR11
SUR11
SUR60
SUR60
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC48145
1 x Y20624
$36.00
Haplogroup Info
Other products
Currencies