Top » Catalog » R1a » SUR5

$18.00

SUR5
[SUR5]

SUR5
hg38 Position: ChrY:14851988..14851988
Ancestral: A
Derived: G
Reference: EHP Suyun
ISOGG Haplogroup: R1a (not listed)
Comments: Approx. Y2632
Forward Primer: SUR5_F ATCCCTCTTTCTGCAAGGTG
Reverse Primer: SUR5_R CCTGACCTCAAGGGATTCAC
Reviews

Customers who bought this product also purchased
SUR52
SUR52
SUR76
SUR76
SUR57
SUR57
SUR85
SUR85
SUR13
SUR13
SUR63
SUR63
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies