Top » Catalog » R1a » SUR87

$18.00

SUR87
[SUR87]

SUR87
hg38 Position: ChrY:16753876..16753876
Ancestral: T
Derived: C
Reference: EHP Suyun
ISOGG Haplogroup: R1a (not listed)
Comments: Approx. Y2632
Forward Primer: SUR87_F AAAATCAACCATGAGCACCAC
Reverse Primer: SUR87_R CCAGCCTCAAAAACTTCTGG
Reviews

Customers who bought this product also purchased
SUR3
SUR3
SUR72
SUR72
SUR54
SUR54
SUR81
SUR81
SUR11
SUR11
SUR59
SUR59
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC2581
1 x BY25698
$36.00
Haplogroup Info
Other products
Currencies