Top » Catalog » R1a » SUR87

$18.00

SUR87
[SUR87]

SUR87
hg38 Position: ChrY:16753876..16753876
Ancestral: T
Derived: C
Reference: EHP Suyun
ISOGG Haplogroup: R1a (not listed)
Comments: Approx. Y2632
Forward Primer: SUR87_F AAAATCAACCATGAGCACCAC
Reverse Primer: SUR87_R CCAGCCTCAAAAACTTCTGG
Reviews

Customers who bought this product also purchased
SUR11
SUR11
SUR59
SUR59
SUR93
SUR93
SUR246
SUR246
SUR65
SUR65
SUR53
SUR53
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies