Top » Catalog » R1a » A8372

$18.00

A8372
[A8372]

A8372
hg38 Position: ChrY:9609315..9609315
Ancestral: C
Derived: T
Reference: Tom Smith (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP1426
Forward Primer: A8372_F CACACCTGGACAGTAACATACAAAAG
Reverse Primer: A8372_R GATTATAGGCATGAGCCACAAC
Reviews

Customers who bought this product also purchased
A8375
A8375
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies