Top » Catalog » R1a » A8375

$18.00

A8375
[A8375]

A8375
hg38 Position: ChrY:14823747..14823747
Ancestral: T
Derived: G
Reference: Tom Smith (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP1426
Forward Primer: A8375_F TGAAGGGACATTTAGTACGTAATTTATC
Reverse Primer: A8375_R GGAAATTAGAGAAAAACCTGGAGAAC
Reviews

Customers who bought this product also purchased
A8372
A8372
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies