Top » Catalog » R1a » A8379

$18.00

A8379
[A8379]

A8379
hg38 Position: ChrY:20974393..20974393
Ancestral: C
Derived: G
Reference: Tom Smith (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP1426
Forward Primer: A8379_F GTTGGGGGTCACTCTTTGAC
Reverse Primer: A8379_R GTAATTGACATTGCAAACTTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies