Top » Catalog » R1a » A8985

$18.00

A8985
[A8985]

A8985
hg38 Position: ChrY:6787031..6787031
Ancestral: G
Derived: A
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8985_F GGGCTTACCTTTTCCTCCTG
Reverse Primer: A8985_R GCCAAAGAGGAAGCAAGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies