Top » Catalog » R1a » A8986

$18.00

A8986
[A8986]

A8986
hg38 Position: ChrY:7038342..7038342
Ancestral: C
Derived: G
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8986_F TGCACCTTTCACTCCAAATG
Reverse Primer: A8986_R TCAATCACAGCATGGCTGAC
Reviews

Customers who bought this product also purchased
A8993
A8993
A8987
A8987
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies