Top » Catalog » R1a » A8987

$18.00

A8987
[A8987]

A8987
hg38 Position: ChrY:13403048..13403048
Ancestral: T
Derived: G
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8987_F TGCCTCGATAGCAGTTTGATC
Reverse Primer: A8987_R CTGGCGACAGAAGGAGATTC
Reviews

Customers who bought this product also purchased
A8986
A8986
A8993
A8993
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies