Top » Catalog » R1a » A8989

$18.00

A8989
[A8989]

A8989
hg38 Position: ChrY:13767234..13767234
Ancestral: G
Derived: A
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8989_F CTAGGTATGAAGCAAAGGTCAGC
Reverse Primer: A8989_R TCAACCTGCAACCCAATTAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies