Top » Catalog » R1a » A8993

$18.00

A8993
[A8993]

A8993
hg38 Position: ChrY:17146018..17146018
Ancestral: A
Derived: T
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8993_F CCGTGTCCTCTTCTGACACC
Reverse Primer: A8993_R GCCAATTGTCCTTCTTTTGG
Reviews

Customers who bought this product also purchased
A8987
A8987
A8986
A8986
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies