Top » Catalog » R1a » A8993

$18.00

A8993
[A8993]

A8993
hg38 Position: ChrY:17146018..17146018
Ancestral: A
Derived: T
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8993_F CCGTGTCCTCTTCTGACACC
Reverse Primer: A8993_R GCCAATTGTCCTTCTTTTGG
Reviews

Customers who bought this product also purchased
A8987
A8987
A8986
A8986
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies