Top » Catalog » R1a » A8995

$18.00

A8995
[A8995]

A8995
hg38 Position: ChrY:12338757..12338757
Ancestral: C
Derived: A
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8995_F CTTTTAGGAGGACTACACTGCAATCTAC
Reverse Primer: A8995_R ACAGATATCCTTCTAAGAGACAGAAGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies