Top » Catalog » R1a » A8996

$18.00

A8996
[A8996]

A8996
hg38 Position: ChrY:8485194..8485194
Ancestral: A
Derived: G
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8996_F GTCTCGAACAGAGATTTACTCACG
Reverse Primer: A8996_R GCCTGGATGCTTAAATTCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies