Top » Catalog » R1a » A8998

$18.00

A8998
[A8998]

A8998
hg38 Position: ChrY:12807063..12807063
Ancestral: G
Derived: A
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8998_F TCAGTCAAGACTCCCTTCTGC
Reverse Primer: A8998_R GCAGACAAATGATAAAAGAACACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19141
1 x DYF397
1 x Y9077
1 x Y-GATA-A10
1 x A19352
1 x DYS390
1 x FGC75586
1 x DYS540
1 x S2886
1 x FGC75588
1 x A19154
1 x DYS446
$180.80
Haplogroup Info
Other products
Currencies