Top » Catalog » R1a » A8998

$15.00

A8998
[A8998]

A8998
hg38 Position: ChrY:12807063..12807063
Ancestral: G
Derived: A
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8998_F TCAGTCAAGACTCCCTTCTGC
Reverse Primer: A8998_R GCAGACAAATGATAAAAGAACACG
Reviews

Customers who bought this product also purchased
VK03
VK03
Z91
Z91
YP561
YP561
YP1698
YP1698
M458
M458
YP5295
YP5295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies