Top » Catalog » R1a » A8998

$18.00

A8998
[A8998]

A8998
hg38 Position: ChrY:12807063..12807063
Ancestral: G
Derived: A
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8998_F TCAGTCAAGACTCCCTTCTGC
Reverse Primer: A8998_R GCAGACAAATGATAAAAGAACACG
Reviews

Customers who bought this product also purchased
BY3301
BY3301
YP575
YP575
YP1261
YP1261
CTS1211
CTS1211
Y4459
Y4459
Y61476
Y61476
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies