Top » Catalog » R1a » A8999

$18.00

A8999
[A8999]

A8999
hg38 Position: ChrY:15652865..15652865
Ancestral: G
Derived: A
Reference: Viacheslav Kudryashov (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP682
Forward Primer: A8999_F ACATGCTCAACTCCCTCTGG
Reverse Primer: A8999_R GCTGAGGTCAGGGGTAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4712
1 x Y18130
1 x FGC14706
1 x Y15275
1 x BY22058
1 x A23320
$108.00
Haplogroup Info
Other products
Currencies