Top » Catalog » R1a » A9526

$19.00

A9526
[A9526]

A9526
hg38 Position: ChrY:7144905..7144905
Ancestral: T
Derived: G
Reference: Stanislaw Plewako (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: YP590
Forward Primer: A9526_F CTGCAGACCTAGATAAACAAGGC
Reverse Primer: A9526_R CTTCTGCAAAGAGGGGGTC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies