Top » Catalog » R1a » A9529

$18.00

A9529
[A9529]

A9529
hg38 Position: ChrY:16911716..16911716
Ancestral: A
Derived: T
Reference: Stanislaw Plewako (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: YP590
Forward Primer: A9529_F TGTGTTCATTTCAATAAAAATTGC
Reverse Primer: A9529_R GGAGTTTCCCAGAACAGAAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies