Top » Catalog » R1a » A9531

$18.00

A9531
[A9531]

A9531
hg38 Position: ChrY:17195945..17195945
Ancestral: T
Derived: C
Reference: Stanislaw Plewako (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: YP590
Forward Primer: A9531_F TTATTCGTTTGTCCGTTGAGG
Reverse Primer: A9531_R ACCCTTCTCTTTCGATGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies