Top » Catalog » R1a » A9532

$18.00

A9532
[A9532]

A9532
hg38 Position: ChrY:22233220..22233220
Ancestral: T
Derived: C
Reference: Stanislaw Plewako (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: YP590
Forward Primer: A9532_F TCTTTGAATAAATATTGACACAGTCATG
Reverse Primer: A9532_R AACAGCCTCCTTGCACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies