Top » Catalog » R1a » S6782

$18.00

S6782
[S6782]

S6782
hg38 Position: ChrY:11058372..11058372
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: S6782_F TGGATGGATAGATGGCTTCC
Reverse Primer: S6782_R TCGCTAAATGAAAGGAAATTCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies