Top » Catalog » R1a » Y1389

$18.00

Y1389
[Y1389]

Y1389
hg38 Position: ChrY:2796208..2796208
Ancestral: C
Derived: T
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Found from public sources
Forward Primer: Y1389_F AGTGTTGCCAGTCGTTTTCC
Reverse Primer: Y1389_R AATACAGCCCCTTTGGTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies