Top » Catalog » R1a » Y35

$18.00

Y35
[Y35]

Y35
hg38 Position: ChrY:13582778..13582778
Ancestral: G
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Found from public sources
Forward Primer: Y35_F GCATGACTCTCCATTACCTCTTG
Reverse Primer: Y35_R CCCTACAAGCCTCTTTGCTG
Reviews

Customers who bought this product also purchased
R1a-Z280 Panel
R1a-Z280 Panel
YP343
YP343
YP1626
YP1626
Z92
Z92
Y2608
Y2608
YP237
YP237
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19103
$18.00
Haplogroup Info
Other products
Currencies