Top » Catalog » R1a » Y35

$18.00

Y35
[Y35]

Y35
hg38 Position: ChrY:13582778..13582778
Ancestral: G
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Found from public sources
Forward Primer: Y35_F GCATGACTCTCCATTACCTCTTG
Reverse Primer: Y35_R CCCTACAAGCCTCTTTGCTG
Reviews

Customers who bought this product also purchased
YP371
YP371
YP340
YP340
YP3979
YP3979
Y2613
Y2613
CTS1211
CTS1211
YP1034
YP1034
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies