Top » Catalog » R1a » A11909

$18.00

A11909
[A11909]

A11909
hg38 Position: ChrY:8965749..8965749
Ancestral: C
Derived: T
Reference: Viacheslav Kudryashov (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A11909_F GTAATTATGCAGCATTATTACTGCATATAATATG
Reverse Primer: A11909_R CTAAGAACAGCCCAATCAAAACATAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies